The following questions have been selected to test and consolidate your learning in this area of the CfE Higher syllabus. They will also help you understand the style of question you may encounter in your final exam. The answers for each question can be accessed by clicking to reveal. At the bottom of the section are the relevant homework sheets for this section. The answers can be accessed by clicking the marking guide link. Remember, practice in applying your learning is key to building your confidence and knowledge and improving your exam success.
1. The graph below shows how the temperature of the DNA in a reaction tube is changed during one cycle of the polymerase chain reaction (PCR).
a) Calculate the maximum change in temperature that the reaction tube experiences during one cycle of PCR.
b) State the function of PCR.
c) Describe what happens to the DNA during stage X.
d) Short sections of DNA called primers are involved in Stage Y.
State what happens to these primers during Stage Y.
e) Suggest why the temperature is increased during Stage Z.
f) (i) A forensic scientist discovered a tiny spot of blood at a crime scene.
A sample taken from this spot contained 100 molecules of DNA.
The sample underwent PCR cycles for 40 minutes.
Use the graph to calculate how many molecules of DNA would be
present after this time.
(ii) What process would then allow an individual to be identified from the DNA?
//
2. PCR technology allows scientists to remove tiny samples of DNA from a single hair follicle or white blood cells in a drop of blood and then make numerous copies of it. This process can be very useful in forensic science. In criminal cases, DNA found on the victim can undergo PCR and eventually allow the production of a DNA fingerprint.
The figure below illustrates the DNA fingerprint from a victim, the DNA specimen found on the victim and the DNA fingerprints of three potential
suspects.
(a) (i) Use the DNA fingerprints to identify the guilty suspect.
(ii) Why is it important to include the victim’s DNA fingerprint for analysis?
//
(b) To ensure the DNA specimen is not that of the victim
3. The polymerase chain reaction (PCR) amplifies specific sequences of DNA.
The flow chart below shows how a sample of DNA was treated during a cycle of the PCR procedure.
(a) Explain the purpose of the different heat treatments in Stage 1 and Stage 2.
(b) The number of DNA molecules doubles during each cycle of the PCR procedure.
Caculate the number of cycles needed to produce 128 copies of a single DNA molecule.
(c) The diagram below shows the contents of a tube used in PCR.
Describe the contents of a suitable control tube designed to show that primers are needed in the reaction.
(d) State one practical application of PCR.
HBiolSheet 1_4
The Marking Guide has been made available. Use this where you are having difficulty, to help you understand the question better. Simply copying the answers from the Marking Guide will not help you learn, using it to help you understand the questions/ answers will.
You will need your Glow login to access the Marking Guide.
1. Free DNA nucleotides are needed for DNA replication. Name one other substance that is needed for DNA replication.
2. The diagram below shows part of a DNA molecule during replication.
a) Identify parts X and Y.
b) Name bases 1 and 2.
c) With reference to a DNA molecule, what does the term, anti-parallel mean?
d) A DNA molecule contains 1500 guanine bases and 2000 adenine bases. How many deoxyribose sugar molecules does this DNA molecule contain?
3. During DNA profiling, the polymerase chain reaction (PCR), can be used to amplify a sample of DNA.
The diagram below shows how substances X, Y and Z are involved in the PCR.
It also gives the temperature treatments T1, T2 and T3 at various stages.
a) Name substances X, Y and Z.
b) The statements below describe changes in temperature during the PCR reaction. Answer the questions which follow.
A – heated to 90–95 °C
B – heated to 75 °C
C – cooled to 55–60 °C
D – cooled to 4 °C
i) Which of the changes occurs at T1?
ii) Which of the changes occurs at T2?
iii) Which of the changes occurs at T3?
c) Suggest why DNA polymerase from human sources is not suitable for use in a PCR machine.
d) Explain why species of plants cannot be identified from woody (xylem) material using the PCR technique.
4. During the polymerase chain reaction (PCR), a solution of DNA molecules is heated to separate the double helix into single strands. This “melting” of DNA can be monitored by measuring how much UV light the solution absorbs. By the time the melting is complete tand all the double stranded DNA is unpaired, UV absorption almost doubles (Figure 1). The melting temperature (Tm) of the DNA is taken to be the one where half the base pairs have separated. Tm depends on the number of G-C base pairs in the sample (Figure 2).
a) What is the function of the polymerase chain reaction?
b) What is the value of Tm for the sample shown?
c) What percentage of A-T base pairs does the sample contain?
d) What evidence is there that G-C base pairs confer stability on the DNA double helix?
e) The G-C base pair is held together with three hydrogen bonds and an A-T base pair only contains two hydrogen bonds. Predict the effect of increasing the amount of A-T base pairs in a strand of DNA would have on Tm. Explain your answer.
HBiolSheet 1_4A
The Marking Guide has been made available. Use this where you are having difficulty, to help you understand the question better. Simply copying the answers from the Marking Guide will not help you learn, using it to help you understand the questions/ answers will.
You will need your Glow login to access the Marking Guide.
1. The polymerase chain reaction (PCR) amplifies specific sequences of DNA in vitro.
The flow chart below shows how a sample of DNA was treated during a cycle of the PCR procedure.
(a) Describe the effect of heating the DNA at Stage 1.
(b) Give the reason for decreasing the temperature to 55 °C at Stage 2.
(c) (i) Name the enzyme used to replicate DNA.
(ii) State the role of primers in DNA replication during PCR and explain why two different primers are needed.
(d) The number of DNA molecules doubles each cycle of the PCR procedure.
Calculate the number of cycles needed to produce 128 copies of a single DNA molecule.
(e) The diagram below shows the contents of a tube used in a PCR procedure.
Describe the contents of a suitable control tube designed to show that DNA is needed in a PCR reaction.
2. A scientist was trying to design an investigation using the polymerase chain reaction. The sequence he wished to amplify is part of a gene encoding a protein and is given below.
5’ GCATGTCAATTGGGCCTATATGGCGTGCAATTTGGCCGGCTATATGGCCGTAGC 3’
3’ CCTACAGTTAACCCGGATATACCGCACGTTAAACCGGCCGATATACCGGCATCG 5’
The scientist decided he could only afford to use primers of 6 bases in length.
a) Write down the sequence of the two primers he should order to be made.
b) The scientist carried out the experiment, using appropriate primers of 6 bases in length. He then separated the pieces of DNA he had amplified. What technique would he use to separate the amplified pieces of DNA?
c) The scientist obtained two bands of amplified DNA. Explain under what circumstances two bands of amplified DNA would be obtained in the above experiment.
d) Under what circumstances might the scientist have only seen a single band?
e) When the scientist carried out the experiment he counted 8 bands. Explain why he obtained so many more bands.
f) Suggest how he could improve this experiment to obtain more reliable results.
3. The diagram below shows the possible lengths of fragments resulting from PCR using a variety of primer combinations. The control (ctrl) is added to ensure that the PCR is working correctly.
In a paternity investigation, two women allege that a man has fathered their child. DNA samples from the suspected father, the two women and their children are subject to PCR analysis. The resulting amplified fragments were then separated. The results are shown in the table below. The far left column (mkr) is a DNA size marker and indicates the length that given DNA fragments will migrate during electrophoresis.
a) Explain why Child A has only one STRP2 in common with their mother (mother A).
b) STRP2 occurs has 3 different lengths variants (alleles). How many STRP2 alleles are found amongst our five individuals?
c) STRP2 bands are found higher up the gel than STRP1. Explain why.
d) Did the man father child A? Can you be 100% certain? Explain your answer.
e) Did the man father child B? Can you be 100% certain? Explain your answer
